Review



ultrascript reverse transcriptase  (PCR Biosystems Ltd)


Bioz Verified Symbol PCR Biosystems Ltd is a verified supplier
Bioz Manufacturer Symbol PCR Biosystems Ltd manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    PCR Biosystems Ltd ultrascript reverse transcriptase
    Ultrascript Reverse Transcriptase, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/UltraScript+Reverse+Transcriptase/custom%40b30-11-02%4042650885
    Average 95 stars, based on 385 article reviews
    ultrascript reverse transcriptase - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Episomal and integrated hepatitis B transcriptome mapping uncovers heterogeneity with the potential for drug-resistance.
    Article Snippet: .. Up to 1 μg of RNA was reverse transcribed using a cDNA synthesis kit (PCR Biosystems), following the manufacturer’s protocol. .. Gene expression was quantified using qPCR (SyGreen Blue Mix, PCR Biosystems) with primers specific for the 3’ terminus of all HBV RNAs, referred to as Total HBV RNA, (F: CGGGGCGCACCTCTCTTTA; R:GTGAAGCGAAGTGCACACGG) or specific to the 5’ locus of pC/ pgRNA (F:GGGGAACTAATGACTCTAGCTACC; R:TTTAGGCCCATATTAGTGTTGACA), as reported by us and others17,18,26,72.

    Article Title: Episomal and integrated hepatitis B transcriptome mapping uncovers heterogeneity with the potential for drug-resistance
    Article Snippet: .. Up to 1 μg of RNA was reverse transcribed using a cDNA synthesis kit (PCR Biosystems), following the manufacturer’s protocol. .. Gene expression was quantified using qPCR (SyGreen Blue Mix, PCR Biosystems) with primers specific for the 3’ terminus of all HBV RNAs, referred to as Total HBV RNA, (F: CGGGGCGCACCTCTCTTTA; R:GTGAAGCGAAGTGCACACGG) or specific to the 5’ locus of pC/pgRNA (F:GGGGAACTAATGACTCTAGCTACC; R:TTTAGGCCCATATTAGTGTTGACA), as reported by us and others , , , .

    cDNA Synthesis:

    Article Title: Episomal and integrated hepatitis B transcriptome mapping uncovers heterogeneity with the potential for drug-resistance.
    Article Snippet: .. Up to 1 μg of RNA was reverse transcribed using a cDNA synthesis kit (PCR Biosystems), following the manufacturer’s protocol. .. Gene expression was quantified using qPCR (SyGreen Blue Mix, PCR Biosystems) with primers specific for the 3’ terminus of all HBV RNAs, referred to as Total HBV RNA, (F: CGGGGCGCACCTCTCTTTA; R:GTGAAGCGAAGTGCACACGG) or specific to the 5’ locus of pC/ pgRNA (F:GGGGAACTAATGACTCTAGCTACC; R:TTTAGGCCCATATTAGTGTTGACA), as reported by us and others17,18,26,72.

    Article Title: Oxidative and Molecular–Structural Alterations of Spermatozoa in Swine and Ram Exposed to the Triazole Ipconazole
    Article Snippet: Total RNA extraction was performed according to the NucleoSpin-RNA-Plus kit manufacturer’s instructions (MACHEREY-NAGEL, Germany), and concentrations were determined using a nanospectrophotometer (NanoDrop Lite Plus, Thermo Fisher Scientific, MA, USA) obtaining A260/A280 ratio values between 1.9 and 2.1. .. Retrotranscription was performed according to the specifications of the cDNA synthesis kit (PCRBiosystems, Wayne, PA, USA). .. For real-time PCR, MasterMix ICgreen (Nippon Genetics, Duren, Germany) was used according to the manufacturer’s specifications.

    Article Title: Ex vivo culture of hematopoietic stem and progenitor cells with platelet lysate: Investigating proliferation and erythroid-megakaryocytic lineage effects.
    Article Snippet: Hematopoietic stem and progenitor cells (HSPCs) are valuable for therapies and research due to their selfrenewal and differentiation abilities.. The ex vivo culture of these cells necessitates conditions that maintain their unique properties and provide a niche-like environment.. Human platelet lysate (HPL), a growth factor-rich substance used in stem cell studies, influences various biological pathways.

    Article Title: Jatrorrhizine Isolated from Phellodendron amurense Improves Collagen Homeostasis in CCD-986sk Human Dermal Fibroblast Cells
    Article Snippet: .. Ribospin RNA extraction kit, GeneAll (Seoul, Republic of Korea) was used to extract wrinkle-associated genes to measure mRNA expression. qPCRBIO cDNA Synthesis Kit, PCR Biosystems Ltd. (London, UK) was used to synthesize cDNA from extracted mRNA. cDNA was diluted with Tris/ethylenediamine tetra-acetic acid (EDTA) buffer and used for analysis using PCRmax Eco 48 Real-time PCR system, Cole-Parmer (Vernon Hills, IL, USA). ..

    Article Title: Clinical Features and Genomic Characteristics of Post-pandemic Human Metapneumovirus Infections in Hospitalized Taiwanese Children
    Article Snippet: .. 81 82 2.2 Viral RNA preparation and HMPV identification 83 Viral RNA was extracted using the QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, 84 Germany). cDNA was synthesized from the extracted RNA using the UltraScript 2.0 85 cDNA synthesis kit (PCR Biosystems) following the manufacturers' instructions. ..

    Article Title: Pluripotent stem cell-derived chimeric antigen receptor-natural killer cells targeting epidermal growth factor receptor 2 for cancer immunotherapy
    Article Snippet: The cells were then incubated for another 48 h. Three days later, successfully transduced hPSCs were selected using 1 μg/ml puromycin (Sigma-Aldrich). .. Total RNA was extracted from cultured cells using an RNeasy Mini Kit (Qiagen). cDNA was synthesized from RNA using a cDNA synthesis kit (PCR Biosystems, London, UK). .. Reverse transcription (RT)-qPCR was then performed with gene-specific primers (Macrogen, Seoul, Republic of Korea), Power SYBR Green PCR Master Mix, and the VIIA 7 Real-Time PCR System (Applied Biosystems).

    Article Title: Episomal and integrated hepatitis B transcriptome mapping uncovers heterogeneity with the potential for drug-resistance
    Article Snippet: .. Up to 1 μg of RNA was reverse transcribed using a cDNA synthesis kit (PCR Biosystems), following the manufacturer’s protocol. .. Gene expression was quantified using qPCR (SyGreen Blue Mix, PCR Biosystems) with primers specific for the 3’ terminus of all HBV RNAs, referred to as Total HBV RNA, (F: CGGGGCGCACCTCTCTTTA; R:GTGAAGCGAAGTGCACACGG) or specific to the 5’ locus of pC/pgRNA (F:GGGGAACTAATGACTCTAGCTACC; R:TTTAGGCCCATATTAGTGTTGACA), as reported by us and others , , , .

    Article Title: Oxidative and Molecular–Structural Alterations of Spermatozoa in Swine and Ram Exposed to the Triazole Ipconazole
    Article Snippet: Total RNA extraction was performed according to the NucleoSpinRNA-Plus kit manufacturer’s instructions (MACHEREY-NAGEL, Germany), and concentrations were determined using a nanospectrophotometer (NanoDrop Lite Plus, Thermo Fisher Scientific, MA, USA) obtaining A260/A280 ratio values between 1.9 and 2.1. .. Retrotranscription was performed according to the specifications of the cDNA synthesis kit (PCRBiosystems, Wayne, PA, USA). .. For real-time PCR, MasterMix ICgreen (Nippon Genetics, Duren, Germany) was used according to the manufacturer’s specifications.

    Synthesized:

    Article Title: Ex vivo culture of hematopoietic stem and progenitor cells with platelet lysate: Investigating proliferation and erythroid-megakaryocytic lineage effects.
    Article Snippet: Hematopoietic stem and progenitor cells (HSPCs) are valuable for therapies and research due to their selfrenewal and differentiation abilities.. The ex vivo culture of these cells necessitates conditions that maintain their unique properties and provide a niche-like environment.. Human platelet lysate (HPL), a growth factor-rich substance used in stem cell studies, influences various biological pathways.

    Article Title: Clinical Features and Genomic Characteristics of Post-pandemic Human Metapneumovirus Infections in Hospitalized Taiwanese Children
    Article Snippet: .. 81 82 2.2 Viral RNA preparation and HMPV identification 83 Viral RNA was extracted using the QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, 84 Germany). cDNA was synthesized from the extracted RNA using the UltraScript 2.0 85 cDNA synthesis kit (PCR Biosystems) following the manufacturers' instructions. ..

    Article Title: Pluripotent stem cell-derived chimeric antigen receptor-natural killer cells targeting epidermal growth factor receptor 2 for cancer immunotherapy
    Article Snippet: The cells were then incubated for another 48 h. Three days later, successfully transduced hPSCs were selected using 1 μg/ml puromycin (Sigma-Aldrich). .. Total RNA was extracted from cultured cells using an RNeasy Mini Kit (Qiagen). cDNA was synthesized from RNA using a cDNA synthesis kit (PCR Biosystems, London, UK). .. Reverse transcription (RT)-qPCR was then performed with gene-specific primers (Macrogen, Seoul, Republic of Korea), Power SYBR Green PCR Master Mix, and the VIIA 7 Real-Time PCR System (Applied Biosystems).

    RNA Extraction:

    Article Title: Jatrorrhizine Isolated from Phellodendron amurense Improves Collagen Homeostasis in CCD-986sk Human Dermal Fibroblast Cells
    Article Snippet: .. Ribospin RNA extraction kit, GeneAll (Seoul, Republic of Korea) was used to extract wrinkle-associated genes to measure mRNA expression. qPCRBIO cDNA Synthesis Kit, PCR Biosystems Ltd. (London, UK) was used to synthesize cDNA from extracted mRNA. cDNA was diluted with Tris/ethylenediamine tetra-acetic acid (EDTA) buffer and used for analysis using PCRmax Eco 48 Real-time PCR system, Cole-Parmer (Vernon Hills, IL, USA). ..

    Expressing:

    Article Title: Jatrorrhizine Isolated from Phellodendron amurense Improves Collagen Homeostasis in CCD-986sk Human Dermal Fibroblast Cells
    Article Snippet: .. Ribospin RNA extraction kit, GeneAll (Seoul, Republic of Korea) was used to extract wrinkle-associated genes to measure mRNA expression. qPCRBIO cDNA Synthesis Kit, PCR Biosystems Ltd. (London, UK) was used to synthesize cDNA from extracted mRNA. cDNA was diluted with Tris/ethylenediamine tetra-acetic acid (EDTA) buffer and used for analysis using PCRmax Eco 48 Real-time PCR system, Cole-Parmer (Vernon Hills, IL, USA). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Jatrorrhizine Isolated from Phellodendron amurense Improves Collagen Homeostasis in CCD-986sk Human Dermal Fibroblast Cells
    Article Snippet: .. Ribospin RNA extraction kit, GeneAll (Seoul, Republic of Korea) was used to extract wrinkle-associated genes to measure mRNA expression. qPCRBIO cDNA Synthesis Kit, PCR Biosystems Ltd. (London, UK) was used to synthesize cDNA from extracted mRNA. cDNA was diluted with Tris/ethylenediamine tetra-acetic acid (EDTA) buffer and used for analysis using PCRmax Eco 48 Real-time PCR system, Cole-Parmer (Vernon Hills, IL, USA). ..

    Cell Culture:

    Article Title: Pluripotent stem cell-derived chimeric antigen receptor-natural killer cells targeting epidermal growth factor receptor 2 for cancer immunotherapy
    Article Snippet: The cells were then incubated for another 48 h. Three days later, successfully transduced hPSCs were selected using 1 μg/ml puromycin (Sigma-Aldrich). .. Total RNA was extracted from cultured cells using an RNeasy Mini Kit (Qiagen). cDNA was synthesized from RNA using a cDNA synthesis kit (PCR Biosystems, London, UK). .. Reverse transcription (RT)-qPCR was then performed with gene-specific primers (Macrogen, Seoul, Republic of Korea), Power SYBR Green PCR Master Mix, and the VIIA 7 Real-Time PCR System (Applied Biosystems).



    Similar Products

    99
    TaKaRa primescripttm ii 1st strand cdna synthesis kit
    Primescripttm Ii 1st Strand Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/PrimeScript+1st+strand+cDNA+Synthesis+Kit/pmc13123502-115-29-36
    Average 99 stars, based on 1 article reviews
    primescripttm ii 1st strand cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    97
    Quanta Biosciences qscript cdna synthesis kit
    Qscript Cdna Synthesis Kit, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/qScript+cDNA+Synthesis+Kit/custom%4095047-025%4042436854
    Average 97 stars, based on 1 article reviews
    qscript cdna synthesis kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    Jena Bioscience script cdna synthesis kit
    Script Cdna Synthesis Kit, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/SCRIPT+cDNA+Synthesis+Kit/custom%40pcr-511%4042667340
    Average 96 stars, based on 1 article reviews
    script cdna synthesis kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Toyobo quantaccuracy, rt-ramda cdna synthesis kit
    Quantaccuracy, Rt Ramda Cdna Synthesis Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/QuantAccuracy%2C+RT-RamDA+cDNA+Synthesis+Kit/custom%40rmq-101%4010%2E64898%2F2026%2E08%2E25%2E746941
    Average 93 stars, based on 1 article reviews
    quantaccuracy, rt-ramda cdna synthesis kit - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    TaKaRa cdna synthesis kit
    Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/SMARTer+PCR+cDNA+Synthesis+Kit/pmc13090977-105-6-9
    Average 96 stars, based on 1 article reviews
    cdna synthesis kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    PCR Biosystems Ltd ultrascript reverse transcriptase
    Ultrascript Reverse Transcriptase, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/UltraScript+Reverse+Transcriptase/custom%40b30-11-02%4042650885
    Average 95 stars, based on 1 article reviews
    ultrascript reverse transcriptase - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    Bio-Rad iscript1tm cdna synthesis kit
    Iscript1tm Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+synthesis+kit/iScript+cDNA+Synthesis+Kit/pmc12993172-136-9-13
    Average 99 stars, based on 1 article reviews
    iscript1tm cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results